SNAP output for PDB entry 4ihv [SNAP web server]

PDB-id

4ihv; SNAP-derived features in text and JSON formats; DNAproDB

Class

transcription-DNA

Method

X-ray (2.716 Å)

Summary

Crystal structure of fis bound to 27 bp sequence DNA f28 (aaatttgtttgagcgttgagcaaattt)

Reference

Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC (2013): "Control of DNA minor groove width and Fis protein binding by the purine 2-amino group." Nucleic Acids Res., 41, 6750-6760. doi: 10.1093/nar/gkt357.

Abstract

The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis-DNA complex narrows to about half the mean minor groove width of canonical B-form DNA to fit onto the protein surface. G/C base pairs within this segment, which is not contacted by the Fis protein, reduce binding affinities up to 2000-fold over A/T-rich sequences. We show here through multiple X-ray structures and binding properties of Fis-DNA complexes containing base analogs that the 2-amino group on guanine is the primary molecular determinant controlling minor groove widths. Molecular dynamics simulations of free-DNA targets with canonical and modified bases further demonstrate that sequence-dependent narrowing of minor groove widths is modulated almost entirely by the presence of purine 2-amino groups. We also provide evidence that protein-mediated phosphate neutralization facilitates minor groove compression and is particularly important for binding to non-optimally shaped DNA duplexes.